| Primary Identifier | MGI:7520869 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cacna1d |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGCATCAGGATCTAGCA and TCTGTTATCATGTCTGTGCG, which resulted in a 455 bp deletion beginning at Chromosome 14 position 30,196,518 bp and ending after 30,196,972 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000619086 (exon 4) and 315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 2 amino acids later. |
