| Primary Identifier | MGI:7520872 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cacng3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGTAGTGATCAACATC and GCAGCAGGTCCTCCACAACC, which resulted in a 289 bp deletion beginning at Chromosome 7 position 122,671,671 bp and ending after 122,671,959 bp (GRCm38/mm10). This mutation deletes 289 bp from ENSMUSE00001291041 (exon 1) including the start site and is predicted to result in a null allele. |
