|  Help  |  About  |  Contact Us

Allele : Smarcb1<em1Koke> SWI/SNF related BAF chromatin remodeling complex subunit B1; endonuclease-mediated mutation 1, Kornelius Kerl

Primary Identifier  MGI:7520876 Allele Type  Endonuclease-mediated
Gene  Smarcb1 Strain of Origin  (C57BL/6J x DBA)F1
Is Recombinase  false Is Wild Type  false
molecularNote  One of coding cDNA C nucleotides at c.1145-1148 (GRCm39:chr10:g.75732893-75732896) was targeted for deletion using a crRNA (targeting GCCAACACTGCCCCAGCC) and an ssODN template (GGCGAATGAGGCGTCTTGCCAACACTGCCCAGCCTGGTGATGAAGACATCCATGCTCGAC) with CRISPR/Cas9 technology. The deletion causes a frameshift just before the stop codon, which replaces the last 3 endogenous codons with 35 non-endogenous codons.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Smarcb1<1148del>,
  • Smarcb1<1148del>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories