| Primary Identifier | MGI:7520876 | Allele Type | Endonuclease-mediated |
| Gene | Smarcb1 | Strain of Origin | (C57BL/6J x DBA)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | One of coding cDNA C nucleotides at c.1145-1148 (GRCm39:chr10:g.75732893-75732896) was targeted for deletion using a crRNA (targeting GCCAACACTGCCCCAGCC) and an ssODN template (GGCGAATGAGGCGTCTTGCCAACACTGCCCAGCCTGGTGATGAAGACATCCATGCTCGAC) with CRISPR/Cas9 technology. The deletion causes a frameshift just before the stop codon, which replaces the last 3 endogenous codons with 35 non-endogenous codons. |