| Primary Identifier | MGI:7521939 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Null/knockout | Gene | Tbr1 |
| Strain of Origin | C57BL/6NJ | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A 1 nt deletion at cDNA position 402 (c.402del) was created by targeting exon 1 with an sgRNA (targeting GTACCCCAGCCAGCACGGAC) and an ssODN template using CRISPR/Cas9 technology, resulting in a frameshift and premature stop codon (p.A136Pfs*80). Tbr1 transcript Tbr1-201 (ENSMUST00000048934.15) is used as reference for exon number and guide sequence. There is no detectable TBR1 protein expression from this allele. This frameshift mutation was identified in a patient with autism. |
