|  Help  |  About  |  Contact Us

Allele : Tbr1<em1Boro> T-box brain transcription factor 1; endonuclease-mediated mutation 1, Brian Oroak

Primary Identifier  MGI:7521939 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence, Null/knockout Gene  Tbr1
Strain of Origin  C57BL/6NJ Is Recombinase  false
Is Wild Type  false
molecularNote  A 1 nt deletion at cDNA position 402 (c.402del) was created by targeting exon 1 with an sgRNA (targeting GTACCCCAGCCAGCACGGAC) and an ssODN template using CRISPR/Cas9 technology, resulting in a frameshift and premature stop codon (p.A136Pfs*80). Tbr1 transcript Tbr1-201 (ENSMUST00000048934.15) is used as reference for exon number and guide sequence. There is no detectable TBR1 protein expression from this allele. This frameshift mutation was identified in a patient with autism.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tbr1<A136fs>,
  • Tbr1<A136fs>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele