|  Help  |  About  |  Contact Us

Allele : Cd70<em1Kmm> CD70 antigen; endonuclease-mediated mutation 1, Kenneth M Murphy

Primary Identifier  MGI:7521995 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready Gene  Cd70
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Two guide RNAs (caatcgtgtccaaatatttt and cttgagcggccgggaggatt) are used to flank exon 1 with loxP sites.
  • mutations:
  • Insertion
  • synonyms:
  • Cd70<fl>,
  • Cd70<fl>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories