| Primary Identifier | MGI:7522306 | Allele Type | Endonuclease-mediated |
| Attribute String | Inducible, Null/knockout, Recombinase, Reporter | Gene | Foxi3 |
| Transmission | Germline | Strain of Origin | 129S7/SvEvBrd-Hprt1<b-m2> |
| Induced With | tamoxifen | Is Recombinase | true |
| Is Wild Type | false |
| molecularNote | Using CRISPR/cas9 genome editing, the entire coding sequence of the forkhead box I3 (Foxi3 locus on chromosome 6) was replaced with a (from 5' to 3') CreERT2 fusion cDNA, P2A peptide sequence followed by enhanced green fluorescent protein (eGFP), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a polyA signal, and a PGK-neo resistance cassette. This entire construct was electroporated, with CRISPR-assisted targeting vectors (gRNA CCCCCGGGATGGCTCTGATATA), in embryonic stem (ES) cells. |
