| Primary Identifier | MGI:7515007 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dhrs7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCTCATCCTTACATCCCCA and TCTACCCCACAAAAAGGTGG, which resulted in a 1560 bp deletion beginning at Chromosome 12 position 72,656,058 bp and ending after 72,657,617 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000299539 and ENSMUSE00000114560 (exons 3 and 4) and 1213 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 95 and early truncation 7 amino acids later. |
