|  Help  |  About  |  Contact Us

Allele : Dhrs7<em1(IMPC)J> dehydrogenase/reductase 7; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7515007 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dhrs7
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCTCATCCTTACATCCCCA and TCTACCCCACAAAAAGGTGG, which resulted in a 1560 bp deletion beginning at Chromosome 12 position 72,656,058 bp and ending after 72,657,617 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000299539 and ENSMUSE00000114560 (exons 3 and 4) and 1213 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 95 and early truncation 7 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele