| Primary Identifier | MGI:7515012 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dimt1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGCAATCGGTTCTACTGGT and TTCTGGCAAGAAACACAGGG, which resulted in a 1536 bp deletion beginning at Chromosome 13 position 106,948,451 bp and ending after 106,949,986 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120073, ENSMUSE00000120072, ENSMUSE00000120070, ENSMUSE00000311714 (exons 3,4,5 and 6) and 1243 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 20 amino acids later. |
