|  Help  |  About  |  Contact Us

Allele : Nwd1<em1(IMPC)J> NACHT and WD repeat domain containing 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7515017 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nwd1
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTGTAATAGTCACACCATC and ACTTGCGTTTGAGATCACAG, which resulted in a 546 bp deletion beginning at Chromosome 8 position 72,662,018 bp and ending after 72,662,563 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000981978 (exon 4) and 248 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 8 amino acids later. There is a 4 bp insertion at the deletion site (TTGA).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories