| Primary Identifier | MGI:7543712 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Prr16 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGCTGTAGATCAGAGGTCA and TGGTAGTGGTGGATTTCCTC, which resulted in a 708 bp deletion beginning at Chromosome 18 position 51,302,635 bp and ending after 51,303,342 bp (GRCm38/mm10). This mutation deletes 708 bp from ENSMUSE00000707416 (exon 2) and because of the 1 bp G insertion is predicted to cause a change of amino acid sequence after residue 61 and early truncation 12 amino acids later. There is a 1 bp insertion (G) at the deletion site. |
