|  Help  |  About  |  Contact Us

Allele : Prr16<em1(IMPC)J> proline rich 16; endonuclease-mediated mutation, Jackson

Primary Identifier  MGI:7543712 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prr16
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGCTGTAGATCAGAGGTCA and TGGTAGTGGTGGATTTCCTC, which resulted in a 708 bp deletion beginning at Chromosome 18 position 51,302,635 bp and ending after 51,303,342 bp (GRCm38/mm10). This mutation deletes 708 bp from ENSMUSE00000707416 (exon 2) and because of the 1 bp G insertion is predicted to cause a change of amino acid sequence after residue 61 and early truncation 12 amino acids later. There is a 1 bp insertion (G) at the deletion site.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele