| Primary Identifier | MGI:7543098 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fastkd3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATGGCGTTCATCACCCTG and TTTTTCCTTCAGCGGCTGCA, which resulted in a 1430 bp deletion beginning at Chromosome 13 position 68,583,568 bp and ending after 68,584,997 bp (GRCm38/mm10). This mutation deletes 1430 bp from ENSMUSE00000641296 (exon 2) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 2 amino acids later. |
