|  Help  |  About  |  Contact Us

Allele : Mib1<em1Jlp> MIB E3 ubiquitin protein ligase 1; endonuclease-mediated mutation 1, Jose de la Pompa

Primary Identifier  MGI:7543447 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence, Null/knockout Gene  Mib1
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 530 (AGA) in exon 11 was changed to a stop codon (TGA) (p.R530*) using an sgRNA (targeting TACGCTTATTACGAGCATTC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the same human missense mutation (c.1588C>T) found in some left ventricular noncompaction (LVNC) patients.
  • mutations:
  • Single point mutation
  • synonyms:
  • Mib1<R530X>,
  • Mib1<R530X>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories