|  Help  |  About  |  Contact Us

Allele : Tmx3<em1Jlp> thioredoxin-related transmembrane protein 3; endonuclease-mediated mutation 1, Jose de la Pompa

Primary Identifier  MGI:7543636 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Tmx3
Strain of Origin  C57BL/6-Mib1<em2Jlp> Is Recombinase  false
Is Wild Type  false
molecularNote  Two nucleotides (TT) were deleted from intron 8 (c.579+8_579+9delTT) using a crRNA (targeting CTCAGAAGATGTGGTTCCTG) and an ssODN template with CRISPR/Cas9 technology. This sequence could represent the last two nucleotides of phenylalanine codon 196 (TTT) in an unannotated alternatively spliced transcript, equivalent to codon F193 (TTT) in the human TMX3-204 (ENST00000562706.5) transcript. Another human alternatively spliced transcript TMX3-202 (ENST00000443099.6) has a TT deletion in codon F191 (in its alternative 3' end in what is intron 9 sequence for transcript TMX3-201) (SNP rs143627864), which leads to a frameshift and resulting stop codon (TAA) in place of the phenylalanine codon (F191fs*), in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1em2Jlp allele and created at the same time as the Cep192em1Jlp allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tmx3<F191X>,
  • Tmx3<F191X>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories