|  Help  |  About  |  Contact Us

Allele : Aplnr<em1Lahu> apelin receptor; endonuclease-mediated mutation 1, Liaoyuan A Hu

Primary Identifier  MGI:7532562 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Aplnr
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Isoleucine codon 107 (ATC) in exon 1 was changed to alanine (GCC) (p.I107A) using an sgRNA (targeting CGTACATGTTGACAAAGATG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.I109A mutation that eliminates beta-arrestin recruitment by the encoded G protein coupled receptor after activation.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • APJ I107A,
  • APJ I107A
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories