| Primary Identifier | MGI:7532562 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Aplnr |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Isoleucine codon 107 (ATC) in exon 1 was changed to alanine (GCC) (p.I107A) using an sgRNA (targeting CGTACATGTTGACAAAGATG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.I109A mutation that eliminates beta-arrestin recruitment by the encoded G protein coupled receptor after activation. |
