| Primary Identifier | MGI:7536998 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Hdac7 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Arginine codon 150 (CGC) in exon 5 was changed to histidine (CAC) (p.R150H) using an sgRNA (targeting CCCGCTCCGTGCTTAGCAGCTTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R166H mutation (SNP rs148755202), a protective variant identified in some multiple sclerosis (MS) patients. |