| Primary Identifier | MGI:7537143 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ptx4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGTTTCAGAGATTCCAAC and CCAAGGACCTACCAAGGACC, which resulted in a 631 bp deletion beginning at Chromosome 17 position 25,122,707 bp and ending after 25,123,337 bp (GRCm38/mm10). This mutation deletes 631 bp from ENSMUSE00000362194 (exon 2) and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 11 amino acids later. |
