| Primary Identifier | MGI:7537132 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lsm12 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAAGTGTACCAGGGCAGCG and CCTCTTTTCTATTCTTCCCG, which resulted in a 452 bp deletion beginning at Chromosome 11 position 102,166,982 bp and ending after 102,167,433 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001226230 (exon 3) and 342 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 86 and early truncation 1 amino acid later. |
