| Primary Identifier | MGI:7537141 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Poglut2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATGATAGCAATGTCAATCT and CTATGCAAAGAGGGCCAGAT, which resulted in a 648 bp deletion beginning at Chromosome 1 position 44,114,398 bp and ending after 44,115,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261539 and ENSMUSE00001261784 (exons 3 and 4) and 364 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 130 and early truncation 9 amino acids later. |
