|  Help  |  About  |  Contact Us

Allele : Chchd10<em2Dpn> coiled-coil-helix-coiled-coil-helix domain containing 10; endonuclease-mediated mutation 2, Derek P Narendra

Primary Identifier  MGI:7532644 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Chchd10
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Serine codon 55 (TCA) in exon 3 was changed to leucine (CTG) (p.S55L) using an sgRNA (targeting TAGCCGTGGGCTCAGCTGTA) and an ssODN template using CRISPR/Cas9 technology. The mutation is the equivalent of the human p.S59L mutation found in a family with ALS, frontotemporal dementia (FTD) and myopathy.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • C10<S59L>,
  • C10<S59L>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories