| Primary Identifier | MGI:7532644 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Chchd10 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Serine codon 55 (TCA) in exon 3 was changed to leucine (CTG) (p.S55L) using an sgRNA (targeting TAGCCGTGGGCTCAGCTGTA) and an ssODN template using CRISPR/Cas9 technology. The mutation is the equivalent of the human p.S59L mutation found in a family with ALS, frontotemporal dementia (FTD) and myopathy. |
