| Primary Identifier | MGI:7532638 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Chchd2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exons 1 and 4 were targeted with sgRNAs (targeting CCCGGGTGACTCCTCCGGCC and GTATGTAGTGTTGGTTACTG) using CRISPR/Cas9 technology, resulting in a deletion from the end of exon 1 to most of exon 4 (GRCm39:chr5-5:129910069-129916053). |