|  Help  |  About  |  Contact Us

Allele : Chchd2<em1Dpn> coiled-coil-helix-coiled-coil-helix domain containing 2; endonuclease-mediated mutation 1, Derek P Narendra

Primary Identifier  MGI:7532638 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Chchd2
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Exons 1 and 4 were targeted with sgRNAs (targeting CCCGGGTGACTCCTCCGGCC and GTATGTAGTGTTGGTTACTG) using CRISPR/Cas9 technology, resulting in a deletion from the end of exon 1 to most of exon 4 (GRCm39:chr5-5:129910069-129916053).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • C2<->,
  • C2<->,
  • C2 KO,
  • C2 KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories