|  Help  |  About  |  Contact Us

Allele : Stat3<em1Ccg> signal transducer and activator of transcription 3; endonuclease-mediated mutation 1, Christopher C Goodnow

Primary Identifier  MGI:7537035 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Stat3
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Threonine codon 716 (ACG) in exon 23 was changed to methionine (ATG) (p.T716M) using an sgRNA (targeting CAGGTCAATGGTATTGCTGCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the TA domain of the encoded peptide, is the equivalent of the same human gain-of-function (GOF) mutation associated with T cell large granular lymphocytic leukemia (T-LGL).
  • mutations:
  • Single point mutation
  • synonyms:
  • Stat3<T716M>,
  • Stat3<T716M>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories