| Primary Identifier | MGI:7537035 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Stat3 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Threonine codon 716 (ACG) in exon 23 was changed to methionine (ATG) (p.T716M) using an sgRNA (targeting CAGGTCAATGGTATTGCTGCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the TA domain of the encoded peptide, is the equivalent of the same human gain-of-function (GOF) mutation associated with T cell large granular lymphocytic leukemia (T-LGL). |
