| Primary Identifier | MGI:7529021 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Null/knockout | Gene | Cfap57 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 18 was targeted with an sgRNA (targeting GGTCCTCTTCGCTTAAATACTAG) using CRISPR/Cas9 technology, resulting in a 7 bp deletion (GAAGCGA) that leads to a frameshift and premature stop codon (NM_026789.5:c.2865-2871del, p.K956Ffs*4). This mutation essentially mimics the human c.2872C>T (p.R958*) mutation associated with male infertility. |
