| Primary Identifier | MGI:7529134 | Allele Type | Endonuclease-mediated |
| Gene | Cbfa2t3 | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Proline codon 209 (CCT) in exon 5 was changed to threonine (ACT) (p.P209T) using an sgRNA (targeting TTTGTTATCCCTTTTCTGAAGG) and an ssODN template with CRISPR/Cas9 technology. This mutation reduces binding of the encoded peptide to TCF3 and TCF12. |
