|  Help  |  About  |  Contact Us

Allele : Cbfa2t3<em1Cswil> CBFA2/RUNX1 translocation partner 3; endonuclease-mediated mutation 1, Christopher S Williams

Primary Identifier  MGI:7529134 Allele Type  Endonuclease-mediated
Gene  Cbfa2t3 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Proline codon 209 (CCT) in exon 5 was changed to threonine (ACT) (p.P209T) using an sgRNA (targeting TTTGTTATCCCTTTTCTGAAGG) and an ssODN template with CRISPR/Cas9 technology. This mutation reduces binding of the encoded peptide to TCF3 and TCF12.
  • mutations:
  • Single point mutation
  • synonyms:
  • Mtg16<P209T>,
  • Mtg16<T>,
  • Mtg16<P209T>,
  • Mtg16<T>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories