| Primary Identifier | MGI:7526755 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Chd2 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Arginine codon 1684 (CGT) was changed to histidine (CAT) (c.5051G>A, p.R1684H) using an sgRNA (targeting CCCACCGTTCTGGGAGCTACCGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human c.5054G>A p.R1684H mutation associated with autism. |
