|  Help  |  About  |  Contact Us

Allele : Ntrk2<em1Tac> neurotrophic tyrosine kinase, receptor, type 2; endonuclease-mediated mutation 1, Taconic

Primary Identifier  MGI:7529665 Allele Type  Endonuclease-mediated
Gene  Ntrk2 Strain of Origin  C57BL/6NTac
Is Recombinase  false Is Wild Type  false
molecularNote  Tyrosine codon 433 (TAT) in exon 12 was changed to phenylalanine (TTC) (NM_001025074:c.1298_1299delATinsTC, p.Y433F) using an sgRNA (targeting TCCTCAGGTCTATGCCGTGGTGG) and an ssODN template with CRISPR/Cas9 technology. This mutation, in the CARC domain of the encoded peptide, affects BDNF-induced translocation of NTRK2 to lipid-raft regions on the neuronal surface.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Ntrk2<em6006(Y433F)Tac>,
  • TRKB.Y433F,
  • TRKB.Y433F,
  • Ntrk2<em6006(Y433F)Tac>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories