| Primary Identifier | MGI:7529665 | Allele Type | Endonuclease-mediated |
| Gene | Ntrk2 | Strain of Origin | C57BL/6NTac |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Tyrosine codon 433 (TAT) in exon 12 was changed to phenylalanine (TTC) (NM_001025074:c.1298_1299delATinsTC, p.Y433F) using an sgRNA (targeting TCCTCAGGTCTATGCCGTGGTGG) and an ssODN template with CRISPR/Cas9 technology. This mutation, in the CARC domain of the encoded peptide, affects BDNF-induced translocation of NTRK2 to lipid-raft regions on the neuronal surface. |
