| Primary Identifier | MGI:7529770 | Allele Type | Endonuclease-mediated |
| Gene | Rptor | Strain of Origin | C57BL/6 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Serine codon 792 (TCC) in exon 20 was changed to alanine (GCG) (p.S792A) using an sgRNA (targeting CGGCGAGGACTCACCTATGAGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue in the encoded peptide to a phosphoblocker. |
