| Primary Identifier | MGI:7518260 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, Null/knockout | Gene | Slc6a1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing used guide RNAs guides (GGTGGTCAGTGGTACTTAGT and GTGGTCAGTGGTACTTAGTG) to insert an LSL targeting vector with a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of exon 7 of the gene. Slc6a1 transcript Slc6a1-201 (ENSMUST00000032454.8) was used as reference for the exon number and guide sequences. |