|  Help  |  About  |  Contact Us

Allele : Tcf7<em1Aben> transcription factor 7, T cell specific; endonuclease-mediated mutation 1, Albert Bendelac

Primary Identifier  MGI:7518204 Allele Type  Endonuclease-mediated
Attribute String  Epitope tag, Reporter Gene  Tcf7
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing used a guide crRNA [CGACCTGAGAATGTTGGTGC] to insert an internal ribosomal entry site (IRES)/mCherry red fluorescent /3XFLAG epitope fusion gene into the 3' UTR of the gene. Tcf transcript Tcf-201 (ENSMUST00000086844.10) was used as reference for the exon number and guide sequences.
  • mutations:
  • Insertion
  • synonyms:
  • Tcf7<mCherry>,
  • Tcf7<mCherry>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories