| Primary Identifier | MGI:7519061 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Il1r1 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 134 (CGG) in exon 4 was changed to glutamic acid (GAA) (p.R134E) using an sgRNA (targeting CACAGGCCACCTTCCCACAGCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.K131E mutation found in a patient suffering from erosive arthritis and osteomyelitis. |
