| Primary Identifier | MGI:7518987 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Eid3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGCTGCCATGCCAGACTC and CGTTATATCTTTGAGTTTAC, which resulted in a 998 bp deletion beginning at Chromosome 10 position 82,866,770 bp and ending after 82,867,767 bp (GRCm38/mm10). This mutation deletes 998 bp from ENSMUSE00001385020 (exon 1) and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 10 amino acids later. |
