| Primary Identifier | MGI:7519009 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zbtb8os |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTTACAAACATCCTATAT and GTTGAGTTATATAATTTACA, which resulted in a 671 bp deletion beginning at Chromosome 4 position 129,341,314 bp and ending after 129,341,984 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001231489 and ENSMUSE00001243208 (exons 3 and 4) and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 1 amino acid later. |
