| Primary Identifier | MGI:7518993 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ppfibp1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGAGACTTTGATTTAGCGC and ATTGTGATCCTGTAAACTGC, which resulted in a 439 bp deletion beginning at Chromosome 6 position 146,997,890 bp and ending after 146,998,328 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001294346 (exon 9) and 324 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 232 and early truncation 17 amino acids later. |
