|  Help  |  About  |  Contact Us

Allele : Nhlrc1<em1Tcp> NHL repeat containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7545165 Allele Type  Endonuclease-mediated
Attribute String  Epitope tag Gene  Nhlrc1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  This allele was generated at The Centre for Phenogenomics by microinjecting Cas9 mRNA with a guide RNA with the spacer sequence AGCGGAGCAGCGGGAGCAAT and a single-stranded oligonucleotide repair template. This resulted in the insertion of a FLAG tag at the N-terminus.
  • mutations:
  • Insertion
  • synonyms:
  • Malin<FLAG>,
  • Malin<FLAG>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories