| Primary Identifier | MGI:7545165 | Allele Type | Endonuclease-mediated |
| Attribute String | Epitope tag | Gene | Nhlrc1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele was generated at The Centre for Phenogenomics by microinjecting Cas9 mRNA with a guide RNA with the spacer sequence AGCGGAGCAGCGGGAGCAAT and a single-stranded oligonucleotide repair template. This resulted in the insertion of a FLAG tag at the N-terminus. |
