| Primary Identifier | MGI:7547374 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Myrf |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A single nucleotide deletion (GRCm39:chr19:10200883Gdel, c.789Cdel) was engineered in exon 6 (in ENSMUST00000189897) using an sgRNA (targeting GGCAAGGCTGTGACAGTCCCAGG) and an ssODN template with CRISPR/Cas9 technology, leading to a frameshift and premature stop codon (p.N264Tfs*8). The mutation is the equivalent of the human c.789Cdel, p.S264Afs*8 mutation associated with nanophthalmos. |
