|  Help  |  About  |  Contact Us

Allele : Bmal1<em1Joli> basic helix-loop-helix ARNT like 1; endonuclease-mediated mutation 1, Jonathan O Lipton

Primary Identifier  MGI:7547390 Allele Type  Endonuclease-mediated
Gene  Bmal1 Strain of Origin  C57BL/6N
Is Recombinase  false Is Wild Type  false
molecularNote  Serine codon 42 (AGT) in exon 5 (in ENSMUST00000047321) was changed to alanine (GCC) (p.S42A) using an sgRNA (targeting GTGTGGACTGCAATCGCAAG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the affected residue in the encoded peptide unphosphorylatable.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Bmal1-S42A,
  • Bmal1-S42A
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories