| Primary Identifier | MGI:7547390 | Allele Type | Endonuclease-mediated |
| Gene | Bmal1 | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Serine codon 42 (AGT) in exon 5 (in ENSMUST00000047321) was changed to alanine (GCC) (p.S42A) using an sgRNA (targeting GTGTGGACTGCAATCGCAAG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the affected residue in the encoded peptide unphosphorylatable. |
