| Primary Identifier | MGI:7548782 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tagln3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGATTCCCTGTGCTGCTTGG and TGATCTCCCATTCTTAATGG, which resulted in a 545 bp deletion beginning at Chromosome 16 position 45,722,809 bp and ending after 45,723,353 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000129242 (exon 2) and 370 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 60 and early stop 10 amino acids later. |
