| Primary Identifier | MGI:7549275 | Allele Type | Endonuclease-mediated |
| Gene | Prkd2 | Inheritance Mode | Semidominant |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Tryptophan codon 807 (TGG) in exon 17 was changed to arginine (AGG) (p.W807R) using an sgRNA (targeting TCTCAGCCACCCATGGTTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation recapitulates the ENU-induced Purnama allele. |
