| Primary Identifier | MGI:7548994 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ppp1r11 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTCTCTCTTGAATTCCTGG and GATTCATACTCTCCACAAAC, which resulted in a 599 bp deletion beginning at Chromosome 17 position 37,260,665 bp and ending after 37,261,263 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000267860 (exon 2) and 490 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 28 and early stop 83 amino acids later. |
