| Primary Identifier | MGI:7565561 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Lck |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Proline codon 440 (CCT) in exon 11 was changed to serine (TCT) (p.P440S) using an sgRNA (targeting CTGGGTAAGGGATTCGACCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is equivalent to the same human mutation associated with combined immunodeficiencies (CID). |