|  Help  |  About  |  Contact Us

Allele : Lck<em1Ewyh> lymphocyte protein tyrosine kinase; endonuclease-mediated mutation 1, Elena W Y Hsieh

Primary Identifier  MGI:7565561 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Lck
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Proline codon 440 (CCT) in exon 11 was changed to serine (TCT) (p.P440S) using an sgRNA (targeting CTGGGTAAGGGATTCGACCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is equivalent to the same human mutation associated with combined immunodeficiencies (CID).
  • mutations:
  • Single point mutation
  • synonyms:
  • Lck<P440S>,
  • Lck<P440S>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories