| Primary Identifier | MGI:7565622 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Donson |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Methionine codon 440 (ATG) in exon 8 was changed to threonine (ACG) (c.1319T>C, p.M440T) using an sgRNA (targeting TACCTTAAGCATTTGCATTG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.M446T mutation associated with microcephalic dwarfism. |
