|  Help  |  About  |  Contact Us

Allele : Donson<em1Anpj> downstream neighbor of SON; endonuclease-mediated mutation 1, Andrew P Jackson

Primary Identifier  MGI:7565622 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Donson
Is Recombinase  false Is Wild Type  false
molecularNote  Methionine codon 440 (ATG) in exon 8 was changed to threonine (ACG) (c.1319T>C, p.M440T) using an sgRNA (targeting TACCTTAAGCATTTGCATTG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.M446T mutation associated with microcephalic dwarfism.
  • mutations:
  • Single point mutation
  • synonyms:
  • Donson<M440T>,
  • Donson<M440T>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele