|  Help  |  About  |  Contact Us

Allele : Igs78<em1Aven> intergenic site 78; endonuclease-mediated mutation 1, Andrea Ventura

Primary Identifier  MGI:7620006 Allele Type  Endonuclease-mediated
Gene  Igs78 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Using CRISPR/Cas9 technology, a guide RNAs (AGATGCGCACAGAAAAGTGG and ATCATGAGTTGAGTTCACTC) were designed to insert loxP sites flanking a 1.7 Mbp genomic region on chromosome 15 (chr15:60646144-62380008) containing the myelocytomatosis oncogene (Myc) gene. This allele is a distal loxP insertion site that pairs with Igs77.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories