| Primary Identifier | MGI:7620006 | Allele Type | Endonuclease-mediated |
| Gene | Igs78 | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Using CRISPR/Cas9 technology, a guide RNAs (AGATGCGCACAGAAAAGTGG and ATCATGAGTTGAGTTCACTC) were designed to insert loxP sites flanking a 1.7 Mbp genomic region on chromosome 15 (chr15:60646144-62380008) containing the myelocytomatosis oncogene (Myc) gene. This allele is a distal loxP insertion site that pairs with Igs77 |